RegulonDB RegulonDB 10.8: Gene Sequence
rpnC gene sequence


Size: 903        A: 241  T: 221  G: 246  C: 195

Fasta

 

>rpnC E. coli K12. Version NC_000913.3 GI:556503834
atggatgcaccgagtaccacaccgcatgacgcggtatttaaacaatttttaatgcatgcg
gagacggctcgcgactttctggagatacatttgccagtggaattacgcgaactttgtgac
ctcaacacgcttcatttagagtcggggagtttcattgaagagagcctgaaaggacacagc
acggacgtgctctattccgtgcaaatgcagggcaatcccggttatctgcatgttgtgatt
gaacaccaaagcaagccggataagaaaatggcctttcgcatgatgcgttattctatagcc
gccatgcaccggcatctggaggctgaccacgataagctgccgctggtggtgccgatactg
ttttatcagggcgaggccacaccttatccgctatcaatgtgctggtttgatatgttttac
tcgccggagctggcgcgacgcgtctataacagtcctttcccgctggtggatatcaccatc
acaccggatgacgaaatcatgcaacatcggcggattgcgattctcgaactactgcaaaaa
catattcgccagcgcgacttaatgttattgcttgagcaactggtcacgctgatcgacgaa
gggtacactagcggaagtcagttagttgccatgcaaaactatatgctgcaacgcggtcat
actgaacaagcggatttgttttacggtgtgttgagagacagggaaacgggaggggagtct
atgatgacgctggcgcagtggtttgaagagaaagggattgagaaggggattcagcaggga
agacaggaagtaagtcaggaattcgcccagcgtcttctgagtaaaggaatgtctcgggaa
gacgttgcagagatggcaaatttacctcttgctgagattgataaggtaattaaccttatt
taa
              
                            

Download fasta file
RegulonDB