RegulonDB RegulonDB 10.9: Gene Sequence
yadE gene sequence


Size: 1230        A: 315  T: 306  G: 319  C: 290

Fasta

 

>yadE E. coli K12. Version NC_000913.3 GI:556503834
atgtacaaacaagctgttattctcctgctgatgctgtttaccgcaagtgtcagtgccgcg
ttacctgcccgttatatgcaaaccatcgaaaatgctgcggtctgggcgcaaattggtgac
aagatggtgaccgtggggaatattcgggccggacaaatcattgccgtggagcccactgcc
gcaagttattacgcatttaattttggctttggcaaaggttttatcgataaaggtcatctc
gagccggttcaggggcgacaaaaagttgaagacggtttgggcgacctcaacaagccgctg
agtaatcagaacttagttacctggaaagatacgccggtctataacgcgccgagtgcggga
agtgcgccatttggggtactggcggacaatttgcgctacccgattttgcataaactgaaa
gacaggttaaatcaaacctggtatcagatccgtattggcgatcgactggcctatatcagc
gcactggatgcccaacccgataatggcctgtcggtgctaacctatcaccatattctgcgc
gacgaagaaaacacccgttttcgccatacttcgacgaccacatcggtacgcgctttcaat
aaccagatggcctggctgcgtgacaggggatacgcgacactgagcatggtgcagctggaa
ggctacgtgaagaataagatcaatctccctgcgcgagcggtggtgattacctttgatgat
ggcctcaagtcggtgagccgctatgcgtatcctgtgttgaaacaatatggcatgaaggcg
acggcgtttattgttacctcacgcatcaaacgtcacccgcagaagtggaacccaaaatcg
ctgcaatttatgagcgtttctgagcttaacgaaattcgcgatgtatttgatttccagtca
catacccattttttgcatcgggtagatggttatcgccgacccatattactgagccgtagt
gagcacaatattctgtttgattttgcacgttcacgccgcgctctggcgcaatttaatccg
catgtctggtatctttcgtatccgtttggcggatttaatgacaacgccgtgaaggcagca
aacgatgccggatttcacctggcggtgacaaccatgaaaggcaaagtaaaaccgggggat
aatccgttgttactaaaacgactttatatcttaagaacggattcgctggagacgatgtcg
cggctggtgagtaaccagccgcagggataa
              
                            

Download fasta file
RegulonDB