RegulonDB RegulonDB 10.9: Gene Sequence
otsA gene sequence


Size: 1425        A: 371  T: 353  G: 359  C: 342

Fasta

 

>otsA E. coli K12. Version NC_000913.3 GI:556503834
atgagtcgtttagtcgtagtatctaaccggattgcaccaccagacgagcacgccgccagt
gccggtggccttgccgttggcatactgggggcactgaaagccgcaggcggactgtggttt
ggctggagtggtgaaacagggaatgaggatcagccgctaaaaaaggtgaaaaaaggtaac
attacgtgggcctcttttaacctcagcgaacaggaccttgacgaatactacaaccaattc
tccaatgccgttctctggcccgcttttcattatcggctcgatctggtgcaatttcagcgt
cctgcctgggacggctatctacgcgtaaatgcgttgctggcagataaattactgccgctg
ttgcaagacgatgacattatctggatccacgattatcacctgttgccatttgcgcatgaa
ttacgcaaacggggagtgaataatcgcattggtttctttctgcatattcctttcccgaca
ccggaaatcttcaacgcgctgccgacatatgacaccttgcttgaacagctttgtgattat
gatttgctgggtttccagacagaaaacgatcgtctggcgttcctggattgtctttctaac
ctgacccgcgtcacgacacgtagcgcaaaaagccatacagcctggggcaaagcatttcga
acagaagtctacccgatcggcattgaaccgaaagaaatagccaaacaggctgccgggcca
ctgccgccaaaactggcgcaacttaaagcggaactgaaaaacgtacaaaatatcttttct
gtcgaacggctggattattccaaaggtttgccagagcgttttctcgcctatgaagcgttg
ctggaaaaatatccgcagcatcatggtaaaattcgttatacccagattgcaccaacgtcg
cgtggtgatgtgcaagcctatcaggatattcgtcatcagctcgaaaatgaagctggacga
attaatggtaaatacgggcaattaggctggacgccgctttattatttgaatcagcatttt
gaccgtaaattactgatgaaaatattccgctactctgacgtgggcttagtgacgccactg
cgtgacgggatgaacctggtagcaaaagagtatgttgctgctcaggacccagccaatccg
ggcgttcttgttctttcgcaatttgcgggagcggcaaacgagttaacgtcggcgttaatt
gttaacccctacgatcgtgacgaagttgcagctgcgctggatcgtgcattgactatgtcg
ctggcggaacgtatttcccgtcatgcagaaatgctggacgttatcgtgaaaaacgatatt
aaccactggcaggagtgcttcattagcgacctaaagcagatagttccgcgaagcgcggaa
agccagcagcgcgataaagttgctacctttccaaagcttgcgtag
              
                            

Download fasta file
RegulonDB