RegulonDB RegulonDB 10.9: Gene Sequence
chaA gene sequence


Size: 1101        A: 229  T: 335  G: 275  C: 262

Fasta

 

>chaA E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaatgctcaagaggcggtaaaaacccgccacaaggagacttcgcttattttcccg
gttctggcgctggtagtgctgttcctgtggggaagcagccagacactaccagtggtcatt
gccatcaatcttcttgcgcttattggtattttaagtagcgcctttagtgttgtccgtcat
gcggacgtattagcccatcgcctgggagaaccttacggttcgcttattcttagcctttca
gtggttattcttgaagtcagtttgatttcagctttaatggcaaccggcgacgccgcgcca
acgctaatgcgtgatacgctctattcaatcattatgattgttaccggtgggctggttggc
ttttcattattgttgggcggtcgtaagtttgccacccaatatatgaatctgtttggtatc
aagcagtatttaattgcgctgttccccctggcgataatcgtactggtatttccaatggct
ctgcctgcggcgaatttttcaaccggtcaggcgttactggtagcattaatttctgcggca
atgtatggcgtatttttgctgatccagaccaaaacgcatcaaagtttgtttgtctacgag
cacgaagatgacagtgatgatgacgacccgcatcacggtaaaccgtctgcccatagcagc
ctgtggcatgctatctggttgattatccatctgattgccgttattgcggtgaccaaaatg
aacgccagctcgctggagacattgctcgacagcatgaatgcccctgtcgcctttactggc
ttcctggtggcactgttgattctgtcgccggaaggtttaggtgcattaaaagcagtgttg
aacaaccaggttcagcgcgcgatgaatctgttctttggttcagtgttagcaaccatttcg
cttaccgtacctgtcgtcacgctaattgcctttatgacgggtaacgaattgcagtttgca
cttggtgcgccagaaatggtggtgatggtggcctctttagtgctgtgccatatctccttc
tccaccggacgtactaacgtgctcaatggcgcagcgcatctggcactgtttgccgcctat
ttgatgacgatatttgcctga
              
                            

Download fasta file
RegulonDB