RegulonDB RegulonDB 10.9: Gene Sequence
setA gene sequence


Size: 1179        A: 241  T: 366  G: 340  C: 232

Fasta

 

>setA E. coli K12. Version NC_000913.3 GI:556503834
atgatctggataatgacgatggctcgccgtatgaacggtgtttacgcggcatttatgctg
gtcgcttttatgatgggggtggccggggcgctacaggctcctacattgagcttatttctg
agtcgtgaggttggcgcgcaacctttctggatcggcctcttttatacggtgaatgctatt
gctgggatcggcgtaagcctctggttggcaaaacgttctgacagtcagggcgatcggcga
aaactgattatattttgctgtttgatggctatcggcaatgcgctattgtttgcatttaat
cgtcattatctgacgcttatcacctgtggtgtgcttctggcatctctggccaatacggca
atgccacagttatttgctctggcgcgggaatatgcggataactcggcgcgagaagtggtg
atgtttagctcggtgatgcgtgcgcagctttctctggcatgggttatcggtccaccgttg
gcctttatgctggcgttgaattacggctttacggtgatgttttcgattgccgccgggata
ttcacactcagtctggtattgattgcatttatgcttccgtctgtggcgcgggtagaactg
ccgtcggaaaatgctttatcaatgcaaggtggctggcaggatagtaacgtacggatgtta
tttgtcgcctcgacgttaatgtggacctgcaacaccatgtacattattgatatgccgttg
tggatcagtagcgagttaggattgccagacaaactggcgggtttcctgatggggacggca
gctggactggaaataccagcaatgattctggctggctactatgtcaaacgttatggtaag
cggcgaatgatggtcatagcagtggcggcaggagtactgttttacaccggattgattttc
tttaatagccgtatggcgttgatgacgctgcaactttttaacgctgtatttatcggcatt
gttgcgggtattgggatgctatggtttcaggatttaatgcctggaagagcgggggcagct
accaccttatttactaacagtatttctaccggggtaattctggctggcgttattcaggga
gcaattgcacaaagttgggggcactttgctgtctactgggtaattgcggttatttctgtt
gtcgcattatttttaaccgcaaaggttaaagacgtttga
              
                            

Download fasta file
RegulonDB