RegulonDB RegulonDB 10.8: Gene Sequence
yciK gene sequence


Size: 759        A: 192  T: 169  G: 194  C: 204

Fasta

 

>yciK E. coli K12. Version NC_000913.3 GI:556503834
atgcattaccagccaaaacaagatttactcaatgatcgcattatcctggtgacgggagcc
agcgatggtattggtcgtgaagccgcgatgacgtatgcacgctatggtgcgacagtgatt
ctgttgggccgtaatgaagaaaaattacgtcaggtagccagccacataaacgaagaaact
gggcgtcagccacagtggtttattctcgatttgctgacctgcacgtccgaaaattgccaa
caactggcacagcgcattgccgttaattatccgcgtctggatggtgttttgcataatgcc
ggattgctcggcgatgtttgcccaatgagcgaacaaaatccgcaggtctggcaggacgtc
atgcaggtcaacgttaatgccacctttatgctcacccaggcactgcttcctttattactc
aaatcggacgccggttcactggtctttacttcatcaagcgttggacgtcagggacgagcc
aactggggtgcatatgcagcgtcgaaatttgccaccgaagggatgatgcaggtactggcc
gatgaatatcagcagcgcctgcgtgtcaactgcattaacccaggcggtacgcgcaccgca
atgcgtgccagcgccttcccgaccgaagatccacagaaacttaaaacacccgctgatatc
atgccgctctacctctggctgatgggcgatgacagccgccgtaaaaccggcatgaccttt
gacgcccaaccgggccgtaaaccaggaatttcccaatga
              
                            

Download fasta file
RegulonDB