RegulonDB RegulonDB 10.9: Gene Sequence
ydcD gene sequence


Size: 483        A: 177  T: 174  G: 84  C: 48

Fasta

 

>ydcD E. coli K12. Version NC_000913.3 GI:556503834
atgcttcaaattattagaggcaaacttgtcatttttttaattaccctttgtttatttgtt
gtttaccttgggtttgataacaattcaaattctgacatcgtattttatggacataaaaca
ccaaagagcgttgagatatatctttctgaaaaaaatattatttataaaataattaatgac
caaaaaattagtagagggaatggtcattttataagtataatggttaataattacaggacg
cactgtggagtggttgatataaatcttaattttttcaatgatattctttatagcgtgcga
ttaaaaaacattagtaaactggagaatatggagttctgcgctacaaaacaacgggtgtat
tttagtgataaaaacaagaaggctagttataaaataattaattatggagactattatgat
gttgattattatgataacaatttgaaaaatgaagtttttgactggattggtaaatggtca
taa
              
                            

Download fasta file
RegulonDB