RegulonDB RegulonDB 10.9: Gene Sequence
ybbC gene sequence


Size: 369        A: 132  T: 124  G: 74  C: 39

Fasta

 

>ybbC E. coli K12. Version NC_000913.3 GI:556503834
atgaaatatagttcaatattttcgatgctttcattttttatactatttgcctgtaatgag
acagctgtttacggttctgatgaaaacattatttttatgaggtatgtggaaaaattacat
ttagataaatactctgttaaaaatacggtaaaaactgaaacaatggcgatacaattagct
gaaatatatgttaggtatcgctatggcgaacggattgcagaagaagaaaaaccatattta
attacggaactaccagatagttgggttgttgagggagcaaagttaccttatgaagttgcg
ggtggtgtatttattatagaaattaataagaaaaatggatgtgttttgaatttcctacat
agtaaataa
              
                            

Download fasta file
RegulonDB