RegulonDB RegulonDB 10.9: Gene Sequence
ybbD gene sequence


Size: 491        A: 163  T: 167  G: 99  C: 62

Fasta

 

>ybbD E. coli K12. Version NC_000913.3 GI:556503834
atgctggctatctcaagtaatctatcaaagatgataatatttatttttgctattataatc
attgttgttttatgcgtaattacttatctttatttatacaaagatgaatctcttgtaagt
aaacattacataaactatatggcaataccagaaaatgatggagtttttacatggctccca
gatttttttccgcacgtagcggtggatatatcaatatacacaaatgtagaagatgattat
ttttttcttatttttccctaacaaatgatgatgggggtaggtttaagaaaacattgacag
tgagggccagggaacaagtggcgaaaatcgtatcaaagaatgatccagatacaaaaaaag
tgtggtgtaaatatggtaagataccagggcaaggggatggtgtaaaccttttttttgttg
gtgaaattaatgttacgcattattttataacaaatattggagctggattgcctgatgctt
gtgcagagtaa
              
                            

Download fasta file
RegulonDB