RegulonDB RegulonDB 10.8: Gene Sequence
nuoM gene sequence


Size: 1530        A: 262  T: 431  G: 432  C: 405

Fasta

 

>nuoM E. coli K12. Version NC_000913.3 GI:556503834
atgttactaccctggctaatattaattccctttattggcggcttcctgtgctggcagacc
gaacgctttggcgtcaaggtgccacgctggatcgcgctgatcaccatgggattgacgctg
gcgctgtcgctgcaactgtggttgcagggcggttattcactgacgcaatccgccggaatt
ccgcagtggcagtctgaattcgacatgccgtggatcccgcgttttggtatctctattcat
ctcgccattgacgggctgtcgctgctgatggtcgtgctgaccggtctgctcggtgtgctg
gcggtactatgttcgtggaaagagatcgaaaaatatcagggcttcttccacctcaacctg
atgtggatcctgggcggcgttatcggcgtgttccttgccatcgacatgttcctgttcttc
ttcttctgggaaatgatgctggtgccgatgtacttcctgatcgcactgtgggggcataaa
gcctctgacggtaaaacgcgtatcacggcggcaaccaagttcttcatttacacccaggcg
agtggcctggtgatgttgattgccatcctggcgctggtttttgttcactacaatgcgacc
ggcgtctggaccttcaactatgaagagctgctgaatacgccaatgtccagtggtgtggaa
tacctgttaatgctgggcttcttcatcgccttcgcagtcaaaatgccggtggttccgctg
catggctggctgccggatgcgcactcccaggctccgaccgccggttccgttgacctcgcg
gggatcttgctgaaaactgccgcttacggtttgctgcgtttctccctgccgctgttcccg
aacgcgtcggcagagttcgcgccaattgctatgtggctgggtgttatcggcatcttctac
ggtgcgtggatggccttcgcccagaccgatatcaaacgtctgatcgcctacacctcggtt
tcccacatgggcttcgtgctgattgctatctacaccggcagccagttggcctaccagggc
gcggtaatccagatgattgcgcacggtttgtcggcggcgggtctgtttattctttgtggt
cagctttatgaacgtatccatacccgcgacatgcgcatgatgggcggtctgtggagcaag
atgaaatggctgccagcactgtcgctgttctttgcggtggcaacgcttgggatgcctggc
accggtaacttcgtcggcgaatttatgattctgttcggcagcttccaggttgtaccggtg
attaccgttatctctacctttgggctggtctttgcatctgtttattcgctggcgatgtta
catcgcgcttacttcggtaaagcgaaaagccagattgccagccaggaactgccagggatg
tcgctgcgtgagctgtttatgatcctgttgctggtggtgctgctggtactgctgggcttc
tatccgcagccgattctggatacctcgcactccgcgattggcaatatccagcagtggttt
gttaattccgttactactacaaggccgtaa
              
                            

Download fasta file
RegulonDB