RegulonDB RegulonDB 11.1: Gene Sequence
ybfE gene sequence


Size: 294        A: 85  T: 51  G: 86  C: 72

Fasta

 

>ybfE E. coli K12. Version NC_000913.3 GI:556503834
atggccaaagaacaaacggaccgtacgacattagatctgttcgcgcacgagcgtcgaccg
ggacgaccgaaaactaatccgctttcgcgcgatgaacagctgcgtattaataaacgcaac
cagctaaaacgcgacaaagtacgtggccttaagcgtgtcgaactgaagctgaacgcggaa
gctgtcgaggcgctgaacgagctggcggagtcgcgcaatatgagccgtagcgaactgatc
gaagagatgttaatgcagcaactggcggcgctgcgtagtcagggcatcgtttaa
              
                            

Download fasta file
RegulonDB