RegulonDB RegulonDB 10.9: Gene Sequence
ybfG gene sequence


Size: 651        A: 194  T: 170  G: 156  C: 131

Fasta

 

>ybfG E. coli K12. Version NC_000913.3 GI:556503834
atgcgtgaaatgaatcagttagtaaatactgaagattcagcctggccaataatccagaac
tggttaaaagacgccacaaaccataccgaactcttaccggttaataaagatttagccgaa
accgcactttatcaattacaggtgacaacaaaatcaccgatgggtgcgcttgtctatggc
tccggaggtctgctgattgataatggttagttacgcatagcaggatctggtcacccccgg
ttgccacgagatccagtaagttggacacaacgccctgaattcgcaggcgtgcgggcttta
cccatcgctgacgatgtcgcaggggtaatttttgctcttaatggtggcgatcttggggaa
gatactggctgcgtttattattttgcgccagatacgctgaattgggaaagtctggaagtt
ggatattctgagtttcttcagtgggcattatccggtgatttagataccttctatgaaaat
gtacgatggcagcaatggcgagaagacgtaataaaattatcggcaacggaagccttcacg
ttctaccctttcttatgggtacaaagtgaagaagcaagaacaagaaaagttatttcgctt
actgaactctgggaaatgcagtatcaaatgaaagaaacattcacgcaataa
              
                            

Download fasta file
RegulonDB