RegulonDB RegulonDB 10.9: Gene Sequence
smpB gene sequence


Size: 483        A: 140  T: 93  G: 124  C: 126

Fasta

 

>smpB E. coli K12. Version NC_000913.3 GI:556503834
atgacgaagaaaaaagcacataaacctggttcagcgaccatcgcgcttaacaagcgcgcc
cgtcacgaatactttatcgaagaagagttcgaagcgggacttgccctgcaaggctgggaa
gttaaatccctgcgcgcaggaaaagccaatatcagcgacagctacgtccttctgcgtgac
ggagaggcatttctgtttggcgctaacatcacgccaatggccgtggcctccacgcatgtg
gtgtgcgatcctacccgtacccgcaagttacttctcaaccagcgcgaactggactcattg
tacggtcgcgtcaatcgagaaggctataccgtagtggcgctctccctgtactggaaaaat
gcctggtgcaaagtgaaaatcggcgtcgccaaaggtaagaaacagcacgataaacgttca
gatatcaaagagcgcgaatggcaggtggataaagcacgtatcatgaaaaacgcccaccgt
taa
              
                            

Download fasta file
RegulonDB