RegulonDB RegulonDB 10.9: Gene Sequence
gmd gene sequence


Size: 1122        A: 268  T: 239  G: 305  C: 310

Fasta

 

>gmd E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaaagtcgctctcatcaccggtgtaaccggacaagacggttcttacctggcagag
tttctgctggaaaaaggttacgaggtgcatggtattaagcgtcgcgcatcgtcattcaac
accgagcgcgtggatcacatttatcaggatccgcacacctgcaacccgaaattccatctg
cattatggcgacctgagtgatacctctaacctgacgcgcattttgcgtgaagtacagccg
gatgaagtgtacaacctgggcgcaatgagccacgttgcggtctcttttgagtcaccagaa
tataccgctgacgtcgacgcgatgggtacgctgcgcctgctggaggcgatccgcttcctc
ggtctggaaaagaaaactcgtttctatcaggcttccacctctgaactgtatggtctggtg
caggaaattccgcagaaagagaccacgccgttctacccgcgatctccgtatgcggtcgcc
aaactgtacgcctactggatcaccgttaactaccgtgaatcctacggcatgtacgcctgt
aacggaattctcttcaaccatgaatccccgcgccgcggcgaaaccttcgttacccgcaaa
atcacccgcgcaatcgccaacatcgcccaggggctggagtcgtgcctgtacctcggcaat
atggattccctgcgtgactggggccacgccaaagactacgtaaaaatgcagtggatgatg
ctgcagcaggaacagccggaagatttcgttatcgcgaccggcgttcagtactccgtgcgt
cagttcgtggaaatggcggcagcacagctgggcatcaaactgcgctttgaaggcacgggc
gttgaagagaagggcattgtggtttccgtcaccgggcatgacgcgccgggcgttaaaccg
ggtgatgtgattatcgctgttgacccgcgttacttccgtccggctgaagttgaaacgctg
ctcggcgacccgaccaaagcgcacgaaaaactgggctggaaaccggaaatcaccctcaga
gagatggtgtctgaaatggtggctaatgacctcgaagcggcgaaaaaacactctctgctg
aaatctcacggctacgacgtggcgatcgcgctggagtcataa
              
                            

Download fasta file
RegulonDB