RegulonDB RegulonDB 10.8: Gene Sequence
fcl gene sequence


Size: 966        A: 225  T: 196  G: 281  C: 264

Fasta

 

>fcl E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaacaacgagtttttattgctggtcatcgcgggatggtcggttccgccatcagg
cggcagctcgaacagcgcggtgatgtggaactggtattacgcacccgcgacgagctgaac
ctgctggacagccgcgccgtgcatgatttctttgccagcgaacgtattgaccaggtctat
ctggcggcggcgaaagtgggcggcattgttgccaacaacacctatccggcggatttcatc
taccagaacatgatgattgagagcaacatcattcacgccgcgcatcagaacgacgtgaac
aaactgctgtttctcggatcgtcctgcatctacccgaaactggcaaaacagccgatggca
gaaagcgagttgttgcagggcacgctggagccgactaacgagccttatgctattgccaaa
atcgccgggatcaaactgtgcgaatcatacaaccgccagtacggacgcgattaccgctca
gtcatgccgaccaacctgtacgggccacacgacaacttccacccgagtaattcgcatgtg
atcccagcattgctgcgtcgcttccacgaggcgacggcacagaatgcgccggacgtggtg
gtatggggcagcggtacaccgatgcgcgaatttctgcacgtcgatgatatggcggcggcg
agcattcatgtcatggagctggcgcatgaagtctggctggagaacacccagccgatgttg
tcgcacattaacgtcggcacgggcgttgactgcactatccgcgagctggcgcaaaccatc
gccaaagtggtgggttacaaaggccgggtggtttttgatgccagcaaaccggatggcacg
ccgcgcaaactgctggatgtgacgcgcctgcatcagcttggctggtatcacgaaatctca
ctggaagcggggcttgccagcacttaccagtggttccttgagaatcaagaccgctttcgg
gggtaa
              
                            

Download fasta file
RegulonDB