RegulonDB RegulonDB 10.8: Gene Sequence
gmm gene sequence


Size: 480        A: 99  T: 119  G: 141  C: 121

Fasta

 

>gmm E. coli K12. Version NC_000913.3 GI:556503834
atgtttttacgtcaggaagactttgccacggtagtgcgctccactccgcttgtctctctc
gactttattgtcgagaacagtcgcggcgagtttctgcttggcaaaagaaccaaccgcccg
gcgcagggttactggtttgtgccgggagggcgcgtgcagaaagacgaaacgctggaagcc
gcatttgagcggctgacgatggcggaactggggctgcgtttgccgataacagcaggccag
ttttacggtgtctggcagcacttttatgacgataacttctctggcacggatttcaccact
cactatgtggtgctcggttttcgcttcagagtatcggaagaagagctgttactgccggat
gagcagcatgacgattaccgctggctgacgtcggacgcgctgctcgccagtgataatgtt
catgctaacagccgcgcctattttctcgctgagaagcgtaccggagtacccggattatga
              
                            

Download fasta file
RegulonDB