RegulonDB RegulonDB 10.8: Gene Sequence
wcaI gene sequence


Size: 1224        A: 284  T: 260  G: 368  C: 312

Fasta

 

>wcaI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatactggtctacggcattaactactcgccggagttaaccggcatcggcaaatac
accggcgagatggtggaatggctggcggcacaaggtcatgaggtgcgggtcattaccgca
ccgccttactacccgcaatggcaggtgggcgagaactattccgcctggcgctacaaacga
gaagagggggccgccacggtgtggcgctgcccgctgtatgtgccaaaacagccgagcacc
ctgaaacgcctgttgcatctgggcagttttgccgtcagcagtttctttccgctgatggcg
caacgtcgctggaagccggatcgcattattggcgtggtgccaacgctgttttgcgcgccg
ggaatgcgcctgctggcgaaactctctggtgcgcgtaccgtgctgcatattcaggattac
gaagtggacgccatgctggggctgggccttgccggaaaaggcaaaggcggcaaagtggca
cagctggcaacggcgttcgaacgtagcggactgcataacgtcgataacgtctccacgatt
tcgcgttcgatgatgaataaagccatcgaaaaaggcgtggcggcggaaaacgtcatcttc
ttccccaactggtcggaaattgcccgttttcagcatgttgcagatgccgatgttgatgcc
cttcgtaaccagcttgacctgccggataacaaaaaaatcattctttactccggcaatatt
ggtgaaaagcaggggctggaaaacgttattgaagctgccgatcgtctgcgcgatgaaccg
ctgatttttgccattgtcgggcagggcggcggcaaagcgcggctggaaaaaatggcgcag
cagcgtggactgcgcaacatgcaatttttcccgctgcaatcgtatgacgctttacccgca
ctgctgaagatgggcgattgccatctggtggtgcaaaaacgcggcgcggcagatgccgta
ttgccgtcgaaactgaccaatattctggcagtaggcggtaacgcggtgattactgctgaa
gcctacacagaactggggcagctttgcgaaacctttccgggcattgcggtttgcgttgaa
ccggaatcggtcgaggcgctggtggcggggatccgtcaggcgctcctgctgcccaaacac
aacacggtggcacgtgaatatgccgaacgcacgctcgataaagagaacgtgttacgtcaa
tttataaatgatattcggggataa
              
                            

Download fasta file
RegulonDB