RegulonDB RegulonDB 10.9: Gene Sequence
ygdD gene sequence


Size: 396        A: 62  T: 118  G: 124  C: 92

Fasta

 

>ygdD E. coli K12. Version NC_000913.3 GI:556503834
atgaccagccgttttatgctgattttcgccgccattagcggcttcatttttgtggctctg
ggcgcttttggcgcgcatgtgttaagtaaaaccatgggggccgttgagatgggctggatc
cagaccggcctcgaataccaggcgtttcatacgctggcgatcttaggtctggcggtggca
atgcagcgtcgcatcagtatctggttttactggagtagcgttttcctcgcgttaggcacg
gtgttgttcagcggcagcctttattgcctggcgctgtcccatctgcgtttgtgggcgttt
gtcactccggttggcggcgtgagcttcctcgcgggctgggcgttaatgttagttggtgct
atccgtttaaagcgcaagggcgtaagtcatgaataa
              
                            

Download fasta file
RegulonDB