RegulonDB RegulonDB 10.9: Gene Sequence
rlmM gene sequence


Size: 1101        A: 258  T: 268  G: 326  C: 249

Fasta

 

>rlmM E. coli K12. Version NC_000913.3 GI:556503834
atgaataaggttgtattgctgtgccgtccgggctttgaaaaagagtgcgccgcagaaatt
accgataaagccggccagcgggaaattttcggttttgcccgcgtgaaagagaatgcgggt
tatgtcatttatgaatgttatcaacctgatgatggcgataagttaatccgtgagctgccg
ttcagttcattaatttttgcccgccagtggtttgtggtgggggaactcctgcagcatttg
ccgccagaagatcgtattacccccattgtcggcatgttacagggcgtagtagagaagggc
ggtgaactgcgtgttgaagttgccgataccaacgaaagcaaagagttactgaaattctgc
cgtaaatttactgttccgctacgcgctgccttgcgcgatgccggggtgctggcgaactat
gaaacgccgaagcgtccggttgtgcatgtattctttattgcaccaggctgctgctatacc
ggttactcatacagcaacaataattcgccgttctatatgggcattccgcgcctgaaattt
ccggcagatgcgccgagtcgttccacgctcaaactggaagaggcatttcatgtgtttatt
cctgcggatgagtgggatgaacgcctggcgaacgggatgtgggcggtggatttaggcgct
tgccctggcggctggacctaccaactggtgaagcgcaacatgtgggtttattccgtcgac
aacggcccgatggcgcaaagtctgatggataccggacaggtgacgtggctgcgggaagac
ggtttcaaattccgtccgacgcgcagcaatatctcctggatggtatgcgatatggttgaa
aaaccggcgaaagttgcggcattgatggcgcagtggctggttaatggctggtgccgtgaa
accattttcaacctcaaactgccgatgaaaaaacgctacgaagaagtgtcacacaatctg
gcgtatattcaggcacagcttgatgaacatggcataaatgctcagattcaggcgcggcag
ttgtatcacgatcgcgaagaagtgacggtgcacgtccgccgcatctgggctgcggtgggt
ggtcgtcgcgacgagcgataa
              
                            

Download fasta file
RegulonDB