RegulonDB RegulonDB 10.9: Gene Sequence
talA gene sequence


Size: 951        A: 257  T: 216  G: 244  C: 234

Fasta

 

>talA E. coli K12. Version NC_000913.3 GI:556503834
atgaacgagttagacggcatcaaacagttcaccactgtcgtggcagacagcggcgatatt
gagtccattcgccattatcatccccaggatgccaccaccaatccttcgctgttactcaaa
gctgccggattatcacaatatgagcatttaatagacgatgctatcgcctggggtaaaaaa
aatggcaagacccaggaacaacaggtggtcgcagcgtgtgacaaactggcggtcaatttc
ggtgctgaaatcctcaaaatcgtacccggtcgcgtgtcaacagaagttgatgcacgcctc
tcttttgataaagaaaagagtattgagaaggcgcgccatctggtggacttgtatcagcaa
caaggcgttgagaaatcacgcattctgatcaagctggcttcgacctgggaaggaattcgc
gcggcagaagagctggaaaaagaaggtattaactgcaacctgacgctgctgttttctttt
gcacaggcacgggcctgtgcggaagcaggcgtttttctgatttcgccgtttgtcgggcgt
atttatgactggtatcaggcacgcaagccgatggacccgtatgtggtggaagaagatccg
ggcgttaaatcggtgcgcaatatctacgactactataagcaacaccactatgaaaccatt
gtgatgggcgcgagcttccgtcgcaccgaacaaatcctcgccttaaccggctgcgatcga
ctgactatcgcaccgaatttactgaaggagctgcaggaaaaagtttcgccagtggtacgt
aaattaatcccaccttctcagacgttcccacgcccagctcccatgagcgaagcggagttc
cgttgggagcacaatcaggatgcgatggcggtagaaaaactgtctgaaggcattcgtctg
ttcgccgttgatcaacgcaaactggaagatcttcttgccgccaaactataa
              
                            

Download fasta file
RegulonDB