RegulonDB RegulonDB 10.9: Gene Sequence
hofC gene sequence


Size: 1203        A: 296  T: 282  G: 331  C: 294

Fasta

 

>hofC E. coli K12. Version NC_000913.3 GI:556503834
atggcgagtaagcaactctggcgctggcatggcataaccggcgacggcaatgcgcaagat
gggatgctatgggcagagagccgtactttactgcttatggcactacagcaacagatggtt
accccactaagcctgaagcgaatcgccatcaattctgcgcagtggcgaggagataaaagc
gcggaagtcattcatcaactggcgacgctactcaaagcagggttaacgctttctgaaggg
ctggctctgctggcggaacagcatcccagtaagcaatggcaagcgttgctgcaatcgctg
gcgcacgatctcgaacagggcattgctttttccaatgccttattaccctggtcagaggta
tttccgccgctctatcaggcgatgatccgcacgggtgaactgaccggtaagctggatgaa
tgctgctttgaactggcgcgtcagcaaaaagcccagcgtcagttgaccgacaaagtgaaa
tcagcgttacgttatcccatcatcattttagcgatggcaatcatggtggttgtggcaatg
ctgcattttgttctgccggagtttgccgctatctataagaccttcaacaccccactaccg
gcactaacgcaggggatcatgacgctggcagactttagtggcgaatggagctggctgctg
gtgttgttcggctttctgctggcgatagccaataagttgctgatgcgccgaccgacctgg
cttatagtgcggcagaaattgctgttacgcatcccgattatgggttcactgatgcgggga
caaaaactcacgcagatctttacgattctggcgctgacacaaagtgcaggcattactttt
ttacagggcgtagagagcgtcagagaaacaatgcgctgcccgtactgggtgcaacttctg
acacaaatccagcacgatatcagtaacggtcaacccatctggctggcgctaaaaaatacc
ggtgagtttagcccgctctgtttgcaattagtgagaacaggagaggcatccggctctctg
gatctcatgttagacaacctcgcccatcatcatcgggaaaacacaatggcgctggcggat
aacctcgcagccttactggaaccggcgttgctgatcataacgggaggaattattggtacg
ctggtggtggcaatgtatctgccaattttccatttaggcgatgcgatgagtgggatggga
taa
              
                            

Download fasta file
RegulonDB