RegulonDB RegulonDB 10.10: Gene Sequence
hybA gene sequence


Size: 987        A: 245  T: 204  G: 281  C: 257

Fasta

 

>hybA E. coli K12. Version NC_000913.3 GI:556503834
gtgaacagacgtaattttattaaagcagcctcctgcggggcattgctgacgggcgcgctg
ccgtctgtcagtcatgcggctgctgaaaaccgcccgccaattccgggatcgctggggatg
ttgtacgactcgaccttgtgcgtaggctgccaggcttgcgtcaccaagtgtcaggatatc
aatttccctgaacgtaacccgcaaggggaacagacctggtcgaacaacgacaaactgtcg
ccgtataccaataacatcattcaggtgtggaccagcggcacaggggtcaacaaagaccag
gaggagaacggctacgcgtacattaagaaacagtgtatgcactgcgtcgatccgaactgt
gtctctgtgtgcccggtctctgcactgaaaaaagatccgaaaaccggcattgtccattac
gacaaagatgtgtgcaccggctgccgttactgcatggtcgcctgtccgtacaacgtgccg
aagtacgactacaacaacccgtttggtgcgctgcataagtgcgagctgtgcaaccagaaa
ggtgtggaacgtctcgataaaggcggtctacctggctgcgtagaagtgtgcccggcgggc
gcggtgattttcggtacgcgtgaagagctgatggcggaggcgaaaaaacgtctggcgctg
aagcctggcagcgaataccactatccgcgtcagacgctgaaatctggcgacacttacctg
catacggtgccgaaatattatccgcatctgtacggcgagaaagagggcggcggtactcag
gttctggtactgacgggtgtgccttatgaaaatctcgacctgccgaaactggacgatctt
tctaccggtgcgcgttccgaaaatattcaacacaccctgtataaaggcatgatgctacca
ctggctgtgctggcgggcttaaccgtgctggttcgtcgcaacaccaaaaacgaccatcac
gacggaggagacgatcatgagtcatga
              
                            

Download fasta file
RegulonDB