RegulonDB RegulonDB 10.9: Gene Sequence
hybB gene sequence


Size: 1179        A: 201  T: 340  G: 344  C: 294

Fasta

 

>hybB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcatgatccacaaccgctgggcggcaaaatcatcagtaaaccggtcatgattttt
ggaccgttaatcgtcatctgtatgctcctgattgtgaagcgtctggtgttcggtctgggc
tctgtctctgacctgaacggcggcttcccgtggggcgtgtggatcgcgtttgacctgctg
attggcaccggctttgcctgtggcggctgggcgctggcgtgggcggtatacgtctttaac
cgtgggcaataccatccgctggtgcgtccggcgctgttggcgagtctgtttggttactca
ctgggtggcttgtcgatcactatcgacgtgggtcgctactggaacctgccgtacttctac
attccgggtcacttcaacgtgaactcggtactgttcgagacggcggtctgtatgaccatc
tatatcggcgtgatggcactggagtttgctccggcactgtttgaacgtctggggtggaag
gtgtcgctacagcgactaaacaaggtgatgttcttcatcatcgcgctcggtgcgctgctg
ccgaccatgcaccagtcttcaatggggtcgctgatgatctcggcgggctacaaggtgcat
ccgttgtggcagagctatgaaatgttgccgctgttctcgctgctgacggcgttcatcatg
ggcttctcgattgtcatctttgaaggttcgctggtgcaggcgggtctgcgtggcaacggt
ccggatgaaaagagtctgtttgttaagctgaccaacaccatcagtgtgttgctggcgatt
ttcatcgtgctgcgctttggcgagcttatctatcgcgacaagctgtcgttagcgtttgcc
ggtgacttctactccgtgatgttctggattgaagtcctgctgatgctcttcccgctggtc
gttctgcgtgtggcgaagctgcgtaatgattcccgcatgctgttcctgtcagcactgagc
gcactgttaggttgtgcaacctggcgtctgacctattcgctggtggcattcaacccgggc
ggcggttacgcctacttcccgacctgggaagaactgttgatttctattggttttgtggct
attgagatttgcgcttacatcgtactcattcgtctactgccgatacttcctcctttaaaa
caaaacgatcataatcgtcatgaggcgagcaaagcatga
              
                            

Download fasta file
RegulonDB