RegulonDB RegulonDB 10.9: Gene Sequence
hybC gene sequence


Size: 1704        A: 412  T: 390  G: 468  C: 434

Fasta

 

>hybC E. coli K12. Version NC_000913.3 GI:556503834
atgagccagagaattactattgatccggtaacccgtattgaggggcatttacgcatcgat
tgcgaaatcgaaaatggcgtcgtttcgaaagcatgggcttccggtaccatgtggcgcggc
atggaagagatcgtgaaaaaccgcgatccgcgcgatgcatggatgattgtgcaacgtatc
tgtggcgtatgtactaccactcacgcgctgtcttccgttcgtgcggcagaaagtgcgctg
aatatcgacgttccggttaacgcgcaatacatccgtaacatcattctggctgcgcacacc
acgcatgaccatattgttcatttctatcagctttcggcgctggactgggtggacatcact
tctgcactgcaagctgacccaaccaaagcctccgaaatgctgaaaggcgtttcgacctgg
cacctgaacagtccggaagagttcaccaaagttcagaacaagatcaaagatctggttgcc
agcggtcagttgggtattttcgctaatggctactggggtcatccggcgatgaaactgccg
ccggaagtgaacctgattgcggtagcgcactacctgcaagcgttggagtgccagcgtgac
gctaaccgcgtcgtggcgctgctgggcggtaaaacgccgcacattcagaacctggcggta
ggtggtgtcgcgaacccgatcaacctcgacggtttgggcgtgctgaaccttgagcgcctg
atgtacatcaagtctttcatcgacaaactgagcgactttgttgagcaggtttataaggtt
gataccgcagttattgccgcgttctacccggaatggctgacacgcggtaaaggtgcggtg
aactacctgagcgtgccggaattcccgaccgacagtaaaaacggcagcttcctgttcccg
ggcggctacattgagaatgcggatctgtcctcgtatcgtccgatcacttctcattccgat
gaatacctgatcaaaggcattcaggaaagcgcgaagcactcctggtataaagacgaagcg
ccgcaggcaccgtgggaaggcaccaccattccggcttatgatggttggtctgacgacggg
aaatattcctgggtgaaatcaccgactttctacggcaaaacggtagaagtggggccactg
gctaatatgctggtgaaactggcggcaggtcgcgaatctacccagaacaaactgaatgaa
atcgttgcgatttatcagaaactgactggcaacacgctggaagtggcacagctgcactcc
acgctgggccgtattattggtcgtaccgttcactgctgtgaattgcaggatatcctgcaa
aaccaatacagtgcactgatcaccaatatcggcaaaggcgatcacaccacctttgtgaag
ccgaacattccggcaacgggtgaattcaaaggtgttggcttcctcgaagcgccgcgcggt
atgctctctcactggatggttattaaagacggtatcatcagcaactaccaggcggttgtt
ccatcaacctggaactctggtccgcgtaacttcaatgatgacgtcggtccttacgagcag
tcgctggtgggtacaccggttgccgatccgaataaaccgctggaagtggtgcgtaccatt
cactcctttgacccgtgcatggcctgtgcggtacacgtagtggatgctgacggcaacgaa
gtggtttcagtgaaggttctgtaa
              
                            

Download fasta file
RegulonDB