RegulonDB RegulonDB 10.10: Gene Sequence
hybD gene sequence


Size: 495        A: 107  T: 117  G: 150  C: 121

Fasta

 

>hybD E. coli K12. Version NC_000913.3 GI:556503834
atgcgtattttagtcttaggggtcggcaatattttgctgaccgatgaagccatcggtgtg
cggattgtcgaagcgttagagcaacgatacattctgccggattatgttgagatcctcgat
ggcggcacggcgggaatggagctgcttggcgacatggcaaatcgcgatcatttgattatt
gcggatgccattgtctcgaaaaagaacgcgccgggaacgatgatgatcctgcgggatgaa
gaagttccggcgttgtttaccaacaaaatctctccgcatcagcttggcctggccgacgtc
ttgtcggccctgcgcttcaccggcgagtttccgaaaaagctgaccctggtcggcgtgatc
ccggaatcgctggagccacacatcggcttaacgccgacggttgaagcaatgattgaacct
gcgcttgagcaggttctggctgcgctgcgtgaatctggcgtggaagccatcccacgggag
gcgattcatgactga
              
                            

Download fasta file
RegulonDB