RegulonDB RegulonDB 10.10: Gene Sequence
hybF gene sequence


Size: 342        A: 70  T: 84  G: 107  C: 81

Fasta

 

>hybF E. coli K12. Version NC_000913.3 GI:556503834
atgcatgagttgtctctttgccagagcgccgttgaaattatccaacggcaggcggagcag
cacgatgttaagcgcgtcaccgccgtgtggctggaaattggcgcgctctcctgcgttgag
gagagcgccgtccgttttagttttgaaattgtctgccacggaacggtggcgcaagggtgc
gatttacatatcgtctataaacccgcccaggcttggtgctgggattgcagccaggtggtg
gagattcatcagcacgatgcgcagtgtccgctctgtcacggcgagcggttgcgtgtcgat
accggcgattcgctgatcgtcaaaagtattgaagttgaataa
              
                            

Download fasta file
RegulonDB