RegulonDB RegulonDB 10.10: Gene Sequence
yebF gene sequence


Size: 357        A: 95  T: 86  G: 105  C: 71

Fasta

 

>yebF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaagaggggcgtttttagggctgttgttggtttctgcctgcgcatcagttttc
gctgccaataatgaaaccagcaagtcggtcactttcccaaagtgtgaagatctggatgct
gccggaattgccgcgagcgtaaaacgtgattatcaacaaaatcgcgtggcgcgttgggca
gatgatcaaaaaattgtcggtcaggccgatcccgtggcttgggtcagtttgcaggacatt
cagggtaaagatgataaatggtcagtaccgctaaccgtgcgtggtaaaagtgccgatatt
cattaccaggtcagcgtggactgcaaagcgggaatggcggaatatcagcggcgttaa
              
                            

Download fasta file
RegulonDB