RegulonDB RegulonDB 11.0: Gene Sequence
purT gene sequence


Size: 1179        A: 250  T: 295  G: 347  C: 287

Fasta

 

>purT E. coli K12. Version NC_000913.3 GI:556503834
atgacgttattaggcactgcgctgcgtccggcagcaactcgcgtgatgttattaggctcc
ggtgaactgggtaaagaagtggcaatcgagtgtcagcgtctcggcgtagaggtgattgcc
gtcgatcgctatgccgacgcaccagccatgcatgtcgcgcatcgctcccatgtcattaat
atgcttgatggtgatgcattacgccgtgtggttgaactggaaaaaccacattatatcgtg
ccggagatcgaagctattgccaccgatatgctgatccaacttgaagaggaaggactgaat
gttgtcccctgcgctcgcgcaacgaaattaacgatgaatcgcgagggtatccgtcgcctg
gcggcagaagagctgcagctgcccacttccacttatcgttttgccgatagcgaaagcctt
ttccgcgaggcggttgctgacattggctatccctgcattgtaaaaccggtgatgagctct
tccggcaaggggcagacgtttattcgttctgcagagcaacttgctcaggcatggaagtac
gctcagcaaggcggtcgcgccggagcgggccgcgtaattgttgaaggcgtcgttaagttt
gacttcgaaattaccctgctaaccgtcagcgcggtggatggcgtccatttctgtgcacca
gtaggtcatcgccaggaagatggcgactaccgtgaatcctggcaaccacagcaaatgagc
ccgcttgcccttgaacgtgcgcaggagattgcccgtaaagtggtgctggcactgggcggt
tatgggttgtttggtgtcgagctatttgtctgtggtgatgaggtgattttcagtgaggtc
tcccctcgtccacatgataccgggatggtgacgttaatttctcaagatctctcagagttt
gccctgcatgtacgtgccttcctcggacttccggttggcgggatccgtcagtatggtcct
gcagcttctgccgttattctgccacaactgaccagtcagaatgtcacgtttgataatgtg
cagaatgccgtaggcgcagatttgcagattcgtttatttggtaagccggaaattgatggc
agccgtcgtctgggggtggcactggctactgcagagagtgttgttgacgccattgaacgc
gcgaagcacgccgccggacaggtaaaagtacagggttaa
              
                            

Download fasta file
RegulonDB