RegulonDB RegulonDB 10.10: Gene Sequence
aidB gene sequence


Size: 1626        A: 330  T: 413  G: 511  C: 372

Fasta

 

>aidB E. coli K12. Version NC_000913.3 GI:556503834
gtgcactggcaaactcacaccgtttttaatcaacctataccattaaataacagcaactta
tacctgtctgatggcgcgctctgcgaagcggtaacgcgtgaaggtgctggctgggatagc
gattttctagccagtattggtcagcagttaggaacggctgaatcccttgaactggggcgg
ctggcgaatgtgaatccgcctgaattattgcgctacgatgcgcaaggacgccgtctggac
gatgtgcgttttcaccccgcctggcacctgctgatgcaggcgctatgtaccaatcgggtg
cacaatcttgcctgggaagaagacgctcgctccggcgcatttgtggcgcgcgcggcgcgt
tttatgttacatgcgcaggttgaggcagggtcgttatgtccgataaccatgacctttgcc
gccacgccattgttgttacagatgttacccgcgccgtttcaggactggaccacgccgcta
ttgagcgatcgctacgattctcacttattgccaggtgggcaaaaacgcggtttgttgatt
ggcatgggaatgacggaaaagcagggcggttccgatgttatgagcaacaccacccgtgca
gagcgtctggaagatggctcttatcggctggtggggcataaatggtttttctcggttccg
caaagcgatgcgcatctggtgctggcgcagaccgcgggtggtctgtcctgcttttttgtg
ccgcgctttttgcctgacgggcaacgcaacgcgattcgcctcgagcggctgaaagataag
ctgggtaatcgctctaacgccagttgcgaagtggagtttcaggatgccattggttggttg
ttggggctggaaggggaaggaattcgtctgatcctgaaaatgggtgggatgacgcgtttt
gattgcgccctgggtagccatgccatgatgcgccgtgcattttcgctggcgatttatcat
gcacatcaacgccatgtttttggtaatccattgatccaacagccccttatgcgtcatgtc
ttaagtcgcatggcacttcagcttgaagggcaaacggcgttgctgtttcgtcttgcgcga
gcgtgggaccggcgtgccgatgccaaagaagccctgtgggcgcgtttatttacgcctgcg
gcaaaatttgtgatctgcaaaagaggtatgccgtttgtggccgaagcgatggaggtgctg
ggcggcattggttattgcgaggagagtgagctgccgcggctttaccgggagatgccggta
aacagtatttgggaaggttccggcaatattatgtgcctggatgtgttgcgcgttctcaat
aagcaagcgggcgtatacgacttattgtcggaagcatttgtggaagtgaaagggcaggat
cgctattttgatcgcgcggttcgtcgtttacagcagcagctgcgtaagccagctgaagaa
ctggggcgagagattactcatcagctattcctgctgggctgcggtgcgcaaatgttgaaa
tatgcttctccgccaatggcgcaggcgtggtgtcaggtgatgttagatacgcgcggcggc
gtacggttgtcagagcagatccagaatgatttattgctgcgggcgacggggggagtgtgt
gtgtaa
              
                            

Download fasta file
RegulonDB