RegulonDB RegulonDB 10.9: Gene Sequence
umpG gene sequence


Size: 762        A: 157  T: 188  G: 224  C: 193

Fasta

 

>umpG E. coli K12. Version NC_000913.3 GI:556503834
atgcgcatattgctgagtaatgatgacggggtacatgcacccggtatacaaacgctggcg
aaagccttgcgtgagtttgctgacgttcaggtggtcgcccccgatcgtaaccgcagcggc
gcttcaaattctctgacactggaatcctccctgcgcacgtttacctttgaaaatggtgat
attgctgtgcaaatgggaaccccgaccgattgcgtctatcttggcgtgaatgctctgatg
cgtccgcgcccggacattgttgtgtccggaattaacgccgggccgaatctgggggatgat
gttatttattccggtacggtagccgccgcgatggaaggccgtcatttaggttttccggcg
cttgccgtctcgcttgacgggcataaacattacgacactgccgcggcggtaacctgttca
attttgcgcgcactgtgtaaagagccgctgcgcaccgggcgtattcttaatattaacgtt
ccggatttacccttggatcaaatcaaaggtattcgcgtgacgcgctgcggtacacgacat
ccggcagatcaggtgatcccgcagcaagatccgcgcggcaatacgctgtactggattggc
ccgccgggcggtaaatgtgatgctggtccggggaccgattttgctgcggtagatgagggc
tatgtctccatcacgccgctgcatgtggatttaactgcgcatagcgcgcaagatgtggtt
tcagactggttaaacagcgtgggagttggcacgcaatggtaa
              
                            

Download fasta file
RegulonDB