RegulonDB RegulonDB 10.9: Gene Sequence
purU gene sequence


Size: 843        A: 217  T: 228  G: 206  C: 192

Fasta

 

>purU E. coli K12. Version NC_000913.3 GI:556503834
atgcattcactccaacgtaaagttctgcgtactatttgtccggaccaaaaaggtctgatc
gcacgtattaccaatatttgctacaagcacgagttaaatatcgtacagaacaatgaattt
gttgatcaccgtaccgggcgcttttttatgcgcacggaactggaagggatttttaatgat
tccaccctgctggcggatctcgatagcgcattgccagaaggctccgtgcgtgagctgaat
cctgccggtcgtcgccggatagtgattctggtcactaaagaagcgcattgccttggcgat
ttgttgatgaaagccaattacggcggcctggatgtcgaaatcgcggcagttattggtaac
cacgatactttacgttctctggttgagcgttttgatattccgtttgagctggtaagccat
gaagggttaacccgcaacgagcacgatcaaaagatggcggatgccattgatgcttatcaa
cctgactacgtggtgctggcgaagtatatgcgggtattaacgccggaatttgtggcacgc
ttcccgaataagatcatcaatattcaccattcattcctgccagcgtttattggcgcacgt
ccttatcaccaggcctatgaacgtggtgtgaagattattggcgcaaccgctcactatgtg
aatgacaatctggacgaaggcccaatcatcatgcaggacgttattcatgtcgatcatacc
tacacagctgaagatatgatgcgcgcaggtcgtgacgtcgagaaaaacgtcttaagtcgt
gcactatacaaagtactggcacagcgcgtctttgtttacggtaatcgaacgattattctt
taa
              
                            

Download fasta file
RegulonDB