RegulonDB RegulonDB 10.9: Gene Sequence
yceI gene sequence


Size: 576        A: 171  T: 132  G: 134  C: 139

Fasta

 

>yceI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaagcctgcttggtttaaccttcgcgtccctgatgttctctgccggttcagcg
gttgccgccgattacaaaattgacaaagaaggtcagcacgcctttgttaatttccgcatc
cagcaccttggctatagctggttatacggcacctttaaagatttcgacggtacttttacc
tttgacgaaaaaaatccggctgccgataaagtgaatgtgacaattaacaccaccagcgtc
gatactaatcacgccgaacgcgataaacatcttcgcagtgcagatttcctcaataccgca
aaatatccacaggcaacattcacctccaccagcgtgaagaaagacggtgacgaactggat
attaccggcgatctgacgctgaatggcgtaaccaaacccgtcacgctggaagcgaaatta
attggtcagggcgacgacccatggggtggtaaacgtgcaggcttcgaggccgaaggcaaa
attaagctcaaggacttcaatatcaagacagatttaggtccagcttctcaggaagtggat
ctgattatttcagtggaaggcgtacagcagaagtaa
              
                            

Download fasta file
RegulonDB