RegulonDB RegulonDB 10.8: Gene Sequence
amiA gene sequence


Size: 870        A: 243  T: 194  G: 217  C: 216

Fasta

 

>amiA E. coli K12. Version NC_000913.3 GI:556503834
atgagcacttttaaaccactaaaaacactcacttcgcgccgccaggtgctgaaagccggt
ttggctgccctgacgttgtcaggaatgtcgcaagccatcgccaaagacgaacttttaaaa
accagcaacggacacagcaagccgaaagccaaaaaatctggcggcaaacgtgtcgttgtt
ctcgatccaggtcacggcggaattgataccggagcgatcggacgcaacggttcgaaagaa
aaacatgtggtgctggcgattgctaaaaacgtccgttccattttgcgtaatcatgggatt
gatgcgcgtttaacgcgttctggcgatacgtttatcccactttacgatcgcgttgaaatc
gcccataaacatggcgcagatctgtttatgtcaattcatgccgatggctttaccaacccg
aaagctgccggtgcttcggtatttgccctctctaaccgtggggcaagtagcgcaatggcg
aaatacctgtctgaacgcgaaaaccgcgccgatgaagttgccggtaaaaaggcgactgac
aaggatcacctattgcaacaagtgctgtttgatctggtgcaaacagataccattaaaaat
agtctgacgctcggctcgcatattctgaagaagattaagccggtgcataaactgcacagc
cgcaacaccgaacaagcggcatttgtggtgttgaaatcaccgtcggttccttcggtgctg
gtggaaacctcgtttatcaccaacccggaagaagaacggctgttaggcacggcggcgttt
cgtcagaaaatcgccacagcgattgctgaaggcgtgatcagttatttccactggttcgac
aaccagaaagcacattcgaaaaagcgataa
              
                            

Download fasta file
RegulonDB