RegulonDB RegulonDB 11.1: Gene Sequence
mobB gene sequence


Size: 528        A: 148  T: 123  G: 153  C: 104

Fasta

 

>mobB E. coli K12. Version NC_000913.3 GI:556503834
atggcaggaaaaacgatgataccgttactcgcctttgccgcgtggagtggtaccggaaaa
actacgcttttgaaaaaactgatcccggcattatgcgccagagggatccgtccagggctg
attaagcatacgcaccatgatatggatgttgataagccaggcaaagatagctatgagctg
cgcaaggctggcgcggcacaaaccatcgttgccagccagcaacgatgggccttgatgacg
gaaacaccagacgaagaagagctggatctacagtttctcgcaagtcgaatggatacctca
aagctggatttgattctggtcgaagggtttaagcatgaagagatcgcaaagattgtgctg
tttcgcgatggagccggacatcgacctgaagaattagtgatagacaggcatgttattgct
gtagccagtgatgtgccgcttaatcttgatgtcgcattactggatattaatgatgttgag
gggctggctgattttgtggtggagtggatgcaaaagcagaacggataa
              
                            

Download fasta file
RegulonDB