RegulonDB RegulonDB 10.9: Gene Sequence
csqR gene sequence


Size: 786        A: 187  T: 187  G: 218  C: 194

Fasta

 

>csqR E. coli K12. Version NC_000913.3 GI:556503834
atgagccttaccgaactaaccggtaacccgcggcacgaccaactcctcatgctgatcgcc
gagcgtgggtatatgaatattgatgagctggcaaatctgctggatgtctccacgcagacg
gtccgccgggatattcgtaaattaagcgagcaaggcctgattacgcgccatcacggtggc
gcgggtcgggcttccagcgtcgttaatacggcgttcgagcagcgtgaggtttcgcaaacc
gaggaaaaaaaagcgattgccgaagcggtggcagactatattcctgatggttcaacaata
tttatcaccattggtacgactgttgagcatgttgcccgggcgttacttaaccataatcat
ttgcggataatcaccaacagcctgcgtgtggcgcatattctttaccacaacccgcgcttt
gaagtgatggtgcccggcggtacgttgcgctctcataatagcgggatcattggcccttca
gcggcgtcctttgtggctgattttcgtgctgattatctggtaacaagcgttggggcgatt
gagagcgatggcgcgttgatggagtttgatgtaaacgaagctaacgtggtgaaaacgatg
atggcgcacgcgagaaatattctgctggtcgccgatcacactaagtatcatgcttcggcg
gcggttgaaattggtaacgtggcacaggtcactgcgctctttaccgacgagctgccgccc
gctgcgctaaaatcacgcttacaagacagccaaattgaaatcattcttccccaggaagac
gcgtag
              
                            

Download fasta file
RegulonDB