RegulonDB RegulonDB 10.9: Gene Sequence
fieF gene sequence


Size: 903        A: 175  T: 257  G: 267  C: 204

Fasta

 

>fieF E. coli K12. Version NC_000913.3 GI:556503834
atgaatcaatcttatggacggctggtcagtcgggcggcgattgctgcgacggcgatggct
tcgctgctattgctgattaaaatttttgcatggtggtataccgggtcggtgagtattctc
gccgcgctggtggattcgctggtggatatcggcgcgtcgttgacgaatttattggtggtg
cgatattccctgcaacctgccgacgataatcactcgtttggtcacggtaaagctgagtcc
ctcgcggcgctggcgcaaagtatgtttatctccggttcggcactattcctgtttttgacg
ggtattcaacatctgatatctccaacaccgatgacagatccaggcgtcggggttatcgtg
acaattgtggcgctaatttgtacgattatccttgtctcgtttcagcgttgggtggtgcgg
cggacgcaaagccaggcggtgcgggctgatatgctacattaccagtctgatgttatgatg
aacggcgcaattctgctggcgctggggttgtcctggtacggctggcatcgcgccgatgct
ctgtttgcattgggaatcggcatctatattttatatagcgcgttacgcatgggatatgag
gcggtacagtcattactggatcgcgcattgcctgatgaggaacggcaagaaattattgat
atcgtgacttcctggccgggtgttagcggcgctcacgatcttcgcacgcggcagtcaggg
ccgacccgctttattcagattcatttggaaatggaagactctctgcctttggttcaggca
catatggtggcggatcaggtagagcaggctattttacggcgttttccgggatcggatgta
attatccatcaggacccctgttccgtcgtacccagggagggtaaacggtctatgctttca
taa
              
                            

Download fasta file
RegulonDB