RegulonDB RegulonDB 10.9: Gene Sequence
uspD gene sequence


Size: 429        A: 132  T: 112  G: 100  C: 85

Fasta

 

>uspD E. coli K12. Version NC_000913.3 GI:556503834
atggcttataaacacattggcgtggcaatttccgggaatgaagaagatgccttactggtg
aataaagccctggagctcgccagacataatgacgctcacctgacgttaattcatattgat
gatggcttaagcgagttgtatccgggtatctacttccctgcaacagaagatattcttcaa
ttgttgaagaataagtcggataacaagctgtataaactgacgaaaaatattcaatggccg
aagacaaaactgcgtattgaacgcggagaaatgccggaaacactgctggaaattatgcaa
aaagagcagtgcgacctccttgtctgtggtcatcatcactcatttatcaaccgtttgatg
ccggcatatcgcgggatgatcaataagatgagtgcggatttgctcatcgtgccgtttatc
gataagtaa
              
                            

Download fasta file
RegulonDB