RegulonDB RegulonDB 10.10: Gene Sequence
yiiX gene sequence


Size: 609        A: 164  T: 126  G: 160  C: 159

Fasta

 

>yiiX E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacaggctgctgatcctcagcctgctggtttctgtacctgcctttgcctggcag
ccacaaaccggcgacatcatctttcagatctctcgctcatcgcaaagtaaagcgatccaa
ctggcgacccataccgattatagccacaccggtatgctggtgatacgcaacaaaaagccc
tacgtttttgaagcagtcggcccggtgaaatacaccccgctcaagcagtggatcgcccat
ggtgaaaagggcaaatacgttgttcgccgcgttgaaggcggactgagtgttgaacaacag
caaaaactggcgcaaacggcaaaacgttatctcggtaaaccgtatgatttcagcttctca
tggagcgacgatcgccagtactgttcggaagtggtgtggaaggtttaccagaacgcgctg
ggaatgcgcgtgggcgagcagcagaagttgaaagagttcgacctgagcagcccacaagtt
caggcaaagctcaaagaacgttacggcaagaatattccgcttgaggaaacggtggtctcg
ccacaagccgttttcgatgcgccacaactcaccacggtcgccaaagaatggccgctgttt
tcgtggtaa
              
                            

Download fasta file
RegulonDB