RegulonDB RegulonDB 10.9: Gene Sequence
tehA gene sequence


Size: 993        A: 181  T: 284  G: 294  C: 234

Fasta

 

>tehA E. coli K12. Version NC_000913.3 GI:556503834
atgcagagcgataaagtgctcaatttgccggcaggctactttggtattgtgttggggacg
atagggatgggatttgcctggcgctatgccagccaggtttggcaggtcagccactggtta
ggggatgggctggtgattctggcgatgatcatctggggattattgactagcgcatttatt
gcccgactcatacgctttccgcatagcgtgctggcggaagttcgccatccagtgctgagc
agttttgtgagtttgtttccggcaacgacgatgctggtggcgattggttttgttccgtgg
tttcgcccactggcggtgtgcctgttcagttttggtgtcgtggttcagttggcttatgcc
gcctggcaaactgcgggattatggcgcggatctcaccctgaagaagctaccacgcctgga
ctgtatctgccgacagttgccaacaactttatcagcgcaatggcctgtggtgcgttgggc
tacaccgacgccggtctggtgtttttaggcgcaggcgttttctcatggctaagccttgaa
ccggtgatcttgcagcgtctgcgcagttcgggagaattacccacggcactgcggacatca
ctcggcattcagctcgctcctgcgctggtggcttgtagtgcctggctgagcgtcaacggc
ggcgagggtgacacgctggcgaaaatgcttttcggttatggactgctgcaactgctgttt
atgctacgtctgatgccatggtatctctcccagccatttaatgcttcattctggagtttc
tcgttcggcgtatctgcactggcaaccaccggtttgcatctggggagtggcagcgataat
ggatttttccatacgctggcggtgccgctgtttatctttaccaattttattattgcaata
ctgctcatccgtacttttgcgcttctgatgcagggaaaattgttagtcagaaccgagcgc
gccgttttaatgaaagcagaggacaaagaatga
              
                            

Download fasta file
RegulonDB