RegulonDB RegulonDB 10.9: Gene Sequence
tehB gene sequence


Size: 594        A: 168  T: 153  G: 146  C: 127

Fasta

 

>tehB E. coli K12. Version NC_000913.3 GI:556503834
atgatcattcgtgacgaaaactattttactgataaatatgaattaacccgcacacactct
gaagtactggaagcggtgaaagtggttaaaccgggtaaaacgctggatctgggctgtggc
aatggtcgtaacagtctttacctggcagccaatggttatgatgttgacgcatgggataaa
aatgccatgagtatcgccaacgtcgagcgcattaaatccattgaaaatctggataattta
cacacccgagtcgttgatctgaataacctcacatttgatagacagtacgattttattctt
tcgactgtggtgctgatgttccttgaggctaaaaccatccccgggttgattgccaatatg
caacgttgcactaaacctggtggttacaacctgattgtggcggcgatggataccgctgat
tatccatgtaccgtcggcttcccgtttgccttcaaagagggagaattacgtcgatattac
gaaggctgggagagggtgaaatacaatgaagacgtcggcgagctgcaccgcaccgacgcc
aacggtaatcgtattaaactgcgtttcgccacgatgctggcacgtaaaaaatga
              
                            

Download fasta file
RegulonDB