RegulonDB RegulonDB 10.9: Gene Sequence
opgG gene sequence


Size: 1536        A: 413  T: 357  G: 396  C: 370

Fasta

 

>opgG E. coli K12. Version NC_000913.3 GI:556503834
atgatgaaaatgcgttggttgagtgctgcagtaatgttaaccctgtatacatcttcaagc
tgggctttcagtattgatgatgtcgcaaagcaagctcaatctttagccgggaaaggctac
gagacgcccaaaagcaacttgccctccgttttccgcgatatgaaatacgcggactatcag
cagatccagtttaatcatgacaaagcgtactggaacaatctgaagaccccattcaaactc
gagttctaccatcagggtatgtacttcgataccccggtcaaaataaatgaagtgactgcc
accgcagtcaaacgaatcaaatacagcccggattatttcactttcggcgatgttcagcat
gacaaagatacggtaaaagaccttggctttgccggttttaaagtgctttacccgatcaac
agcaaagataaaaacgatgaaatcgtcagcatgctcggggccagctatttccgcgtgatt
ggtgcaggtcaggtttatggcctttctgcccgcggcctggcaattgataccgccttgcca
tcgggtgaagaatttccgcgcttcaaagagttctggatcgagcgtccaaaaccgactgat
aaacgtttaaccatctatgcattgcttgactcgccgcgtgcgacaggtgcttacaaattc
gtggttatgccagggcgtgacacggttgtggatgtgcagtcgaaaatctatctgcgcgat
aaagtcggcaaactgggggttgcaccgttaaccagtatgttcctgtttgggccgaaccaa
ccgtcgcctgcaaataactatcgtccggagttgcacgactctaacggtctctctatccat
gccggtaatggcgaatggatctggcgtccgttgaataacccgaaacatttagcggtcagc
agcttctccatggaaaacccgcaaggctttggtctgttgcagcgcggtcgtgatttctcc
cgctttgaagatctcgatgatcgttacgatctccgtccaagcgcatgggtgactccgaaa
ggggagtggggtaaaggcagcgttgagctggtggaaattccaaccaacgatgaaaccaac
gataacatcgtcgcttactggacgccggatcagctgccggagccgggtaaagagatgaac
tttaaatacaccatcaccttcagccgtgatgaagacaaactgcatgcgccagataacgca
tgggtgcaacaaacgcgtcgttcaacgggggatgtgaagcagtcgaacctgattcgccag
cctgacggtactatcgcctttgtggtcgattttaccggcgcagagatgaaaaaactgcca
gaggataccccggtcacagcgcaaaccagcattggtgataatggtgagatagttgaaagc
acggtgcgctataacccggttaccaaaggctggcgtctggtgatgcgtgtgaaagtgaaa
gatgccaagaaaaccactgaaatgcgtgctgcgctggtgaatgccgatcagacgttgagt
gaaacctggagctaccagttacctgccaatgaataa
              
                            

Download fasta file
RegulonDB