RegulonDB RegulonDB 10.9: Gene Sequence
dctR gene sequence


Size: 531        A: 158  T: 162  G: 101  C: 110

Fasta

 

>dctR E. coli K12. Version NC_000913.3 GI:556503834
atgtttcttataattaccagggatacgatgttcttcaccgcgatgaaaaacattctgagt
aaaggtaatgtcgttcatatacagaacgaagaagagatcgacgtaatgttgcatcagaat
gccttcgtcattattgatacattaatgaataatgtatttcattctaattttctcactcaa
attgaacgattaaaacctgtccatgtcattattttctccccctttaatattaaacgctgc
ctggggaaagtgccggtgacctttgttccgcggactatcactatcattgattttgtcgca
ctcatcaatggcagttactgctctgtgcctgaagcggctgtgtcactttcgcgcaagcaa
catcaggttctgagctgcattgcgaatcaaatgacaacggaagatattctggagaaactg
aaaatatcgctaaaaacgttctactgccataaacacaatatcatgatgatcctcaatctt
aagcggatcaatgagctggtacgccatcagcatattgattatctggtgtga
              
                            

Download fasta file
RegulonDB