RegulonDB RegulonDB 10.10: Gene Sequence
yeeA gene sequence


Size: 1059        A: 239  T: 282  G: 278  C: 260

Fasta

 

>yeeA E. coli K12. Version NC_000913.3 GI:556503834
gtgcgtgccgataagtcattaagcccgtttgaaatccgggtataccgccattaccgcatt
gtgcatggtactcgggtcgcgctggcattcctgctcacttttctcattatccgcctgttt
actatcccggaaagcacctggccgctggtcaccatggtggtgattatggggccaatctcg
ttctggggtaacgttgtccctcgcgcctttgagcgtattggcggtacggtgttgggttcg
attttaggtcttatcgctctgcaactggagttaatctcgttaccgctgatgttagtctgg
tgcgcggcggccatgttcctttgcggttggctggcgctgggcaagaaaccgtatcaaggt
ttattgattggggtgacgctggcaattgttgtgggttccccgacaggtgaaattgatacg
gcgttatggcgaagcggcgatgtgatcctcggctctttactggcaatgttgtttaccggt
atctggccacaacgggcgttcatccactggcgcattcaactggcgaaaagtctgaccgag
tataatcgggtctatcaatctgcattctcaccgaacttactcgaacgcccacgtctggaa
agccatctacaaaaactcctgaccgatgccgtgaaaatgcgtggactgattgcgcccgcc
agcaaagaaacccgtattccaaaatcgatatatgaaggtatccagaccattaaccgcaat
ctggtttgtatgctggagttgcaaatcaatgcatactgggccacgcgccccagccatttc
gtgttattgaacgcgcaaaaacttcgtgatacccagcacatgatgcagcaaatactgctg
agccttgttcatgcgctgtacgaaggtaatccgcagccggtttttgccaatacggaaaaa
ttgaacgatgctgtggaagagctgcgtcagttgctcaataaccaccatgacctgaaggtt
gtggaaacaccaatctatggttatgtgtggctgaacatggaaacggcgcatcagcttgag
ttgctatcgaatctgatttgccgggccttgcgcaaataa
              
                            

Download fasta file
RegulonDB