RegulonDB RegulonDB 10.10: Gene Sequence
sbmC gene sequence


Size: 474        A: 130  T: 120  G: 133  C: 91

Fasta

 

>sbmC E. coli K12. Version NC_000913.3 GI:556503834
atgaactacgagattaagcaggaagagaaacgtaccgttgcaggtttccatctcgttggc
ccgtgggaacagacggtaaagaaaggctttgagcagttgatgatgtgggtagatagcaaa
aatattgtgccgaaggagtgggttgctgtctattacgacaatccagatgaaacacccgcc
gaaaaattacgctgcgacaccgtcgtgacggtgccgggttactttacgcttcccgaaaac
agtgagggcgtcattctgacagaaattacaggtggtcagtatgcggtggcggtagctcgt
gtagtcggtgatgattttgctaaaccctggtatcagttctttaatagtctcttgcaggac
agtgcttatgaaatgttaccaaagccctgcttcgaggtttatttgaacaatggcgcggaa
gatgggtactgggatatcgaaatgtatgttgcggtgcagccaaaacatcactaa
              
                            

Download fasta file
RegulonDB