RegulonDB RegulonDB 10.9: Gene Sequence
dacD gene sequence


Size: 1167        A: 289  T: 303  G: 319  C: 256

Fasta

 

>dacD E. coli K12. Version NC_000913.3 GI:556503834
ttgaaacgccgtcttattattgctgcttctttgttcgtttttaacttatcgtctggtttt
gcggcggaaaacattcctttttcacctcagcctccagagattcatgccgggtcctgggta
ttgatggattacaccaccggtcagatcctcaccgcgggtaatgagcatcaacagcgcaat
cccgccagcctgacaaagctgatgacgggttatgtcgtggatcgcgctatcgatagtcat
cgcattacgccagacgatattgtcaccgtggggcgcgatgcgtgggcgaaagataatccg
gtgtttgtcggttcttcactgatgtttttgaaagagggcgatcgcgtatcggtacgtgat
ttaagccgtggtttaattgtggattccggaaatgacgcttgtgttgctctggctgactat
attgccggtgggcaacggcagtttgttgaaatgatgaacaactatgccgagaagctgcat
ctcaaggatacgcattttgaaacagtgcatggtctggatgcacctggccagcatagctcg
gcttatgatttagctgtgctttctcgtgctatcatccacggcgagcccgagttttatcat
atgtacagtgagaaaagtctcacctggaacggtatcacccagcaaaaccgtaacgggttg
ttgtgggataaaaccatgaatgttgacggcctgaaaacgggtcatacttctggtgccggg
tttaatctcattgcttcggctgtagatgggcagcgtcgtctcattgcagtggtaatgggg
gctgacagtgcaaaaggtcgtgaggaagaggcaagaaaattactgcgttgggggcaacaa
aactttactacggtgcaaattttgcaccgtgggaaaaaggtcggaacggaacgcatctgg
tatggcgataaagaaaatatcgacctgggaacggaacaagagttctggatggtgctaccg
aaagccgaaattccacatatcaaagccaaatatacccttgatggtaaagaactcaccgcg
ccaattagcgcccatcagcgggtaggggaaattgaactttacgaccgtgataaacaggtg
gcgcactggccgctggttaccctggaatctgtcggggaaggcagcatgttttctcgcctg
agtgattatttccaccataaggcctga
              
                            

Download fasta file
RegulonDB