RegulonDB RegulonDB 10.9: Gene Sequence
yeeE gene sequence


Size: 1059        A: 210  T: 315  G: 314  C: 220

Fasta

 

>yeeE E. coli K12. Version NC_000913.3 GI:556503834
atgttttcaatgatattaagcgggctaatttgtggtgctctgctgggatttgtcatgcag
cgtgggcgtttttgcctgacaggtggttttcgcgatatgtatatcgtgaaaaataatcgc
atgttttacgccttgctgattgcaatttcggtacaaagcgtgggggtttttgcgttaatt
caggcgggcctactgacttacgaagccggggcgttcccgtggcttggtactgttataggt
gggtatatcttcgggctgggaattgttctggcgggtggatgtgccaccgggacctggtat
cgcgcgggtgagggattgatcggcagttggatcgcgcttttcacttatatggtgatgagt
gcggtgatgcgttctccacatgccagtggtttaaatcaaaccttgcagcactacagtact
gaacataactctattgctgagacttttaatttgtctgtgtggccgttggttgccgttttg
ctggtgataacgctctgggtggtgatgaaagagttgaagaagccaaaactcaaagtcgcg
accttaccgccgcgccgaaccgggatcgctcatattctgtttgaaaaacgctggcatccc
tttgtcacagctgtactcatcggtttgattgcgcttttagcctggcccctgagtgaagca
accggacgcatgtttgggttaggaatcacttccccaacggccaatattctgcaatttctg
gtcgcgggtgacatgaaatacattaactggggcgttttcctggtgttagggatcttcgtg
gggtcatttattgcagccaaagcgagccgtgagttccgcgttcgcgcagctgatgcacaa
acaacattacgtagcgggttaggtggtgtactgatgggcttcggtgccagtattgcaggt
ggttgctctatcggtaatggactggttatgactgcaatgatgacctggcagggctggatt
ggccttgtatttatgattctcggagtctggactgcgtcctggcttgtgtatgttcgaccg
cagcgtaaggcgcgactggcaactgctgcggcaaattaa
              
                            

Download fasta file
RegulonDB