RegulonDB RegulonDB 10.9: Gene Sequence
plaP gene sequence


Size: 1359        A: 256  T: 387  G: 369  C: 347

Fasta

 

>plaP E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcataacgttactccaaacacctctcgcgtggaattgcgtaaaacgcttacgtta
gttccggttgtaatgatgggtcttgcctatatgcagccgatgacgctgtttgatactttt
ggtatcgtttcaggcctcacggatggtcatgtgccgacagcctatgcgttcgcattgatt
gcgatcctgtttacggctctgagctacgggaagctggttcgccgctatccttctgctggc
tctgcatacacttacgcccagaaatccattagcccgactgtcggctttatggtgggttgg
tcttctctgctcgactatctgttcgcgccgatgatcaacattctactggcgaaaatctat
tttgaagctctggtgccttccatcccatcgtggatgtttgtggtggcgctggtggccttt
atgaccgcctttaacctgcgtagtctgaaatccgtagcgaacttcaacactgtaatcgtc
gtgttgcaggtagtgctgatcgcggtgattctgggcatggttgtttatggcgtatttgaa
ggtgaaggcgctggtacgctggcgagcactcgtccattctggtctggcgatgcgcatgtt
atcccgatgattaccggggcgacaatcctgtgcttctcctttaccggctttgacggcatc
agcaacctgtcggaagaaaccaaagatgcagagcgcgtgatcccgcgtgcgattttcctg
accgcgctgatcggcggcatgatcttcatctttgcaacttacttcctgcagctgtacttc
ccggatatctctcgctttaaagatccggatgcgtcacagcctgaaatcatgctgtacgtt
gcgggtaaagcgttccaggttggcgcgctgatcttctccaccattaccgtactggcgtcc
ggtatggcggcgcatgcaggcgtagcgcgtctgatgtacgtaatgggtcgtgacggcgta
ttcccgaaaagcttcttcggttatgtacacccgaaatggcgtactccggcgatgaacatc
atcctggttggcgcgattgccctgctggcaatcaacttcgacctggtaatggcaacggcg
ctgattaactttggtgcgctggtggcgttcactttcgttaacctgtcggtcatctcgcag
ttctggatccgtgagaagcgtaacaagacgctgaaagatcacttccagtatctgttcctg
ccgatgtgtggtgcgctgaccgttggtgcgctgtgggttaacctggaagaaagctcaatg
gttctgggtctgatctgggctgctatcggtctgatttacctggcttgcgtcaccaagagc
ttccgtaatccggttccgcagtacgaagacgtagcataa
              
                            

Download fasta file
RegulonDB