RegulonDB RegulonDB 10.10: Gene Sequence
ralR gene sequence


Size: 195        A: 69  T: 47  G: 49  C: 30

Fasta

 

>ralR E. coli K12. Version NC_000913.3 GI:556503834
atgagatatgacaatgttaaaccatgtccattttgtggttgtccatcagtaacggtgaaa
gccatttcaggatattaccgagcgaagtgtaacggatgcgaatcccgaaccggttatggt
ggaagtgaaaaagaagcactcgaaagatggaataaacgaaccactggaaataataatgga
ggtgttcatgtataa
              
                            

Download fasta file
RegulonDB