RegulonDB RegulonDB 10.10: Gene Sequence
rcbA gene sequence


Size: 210        A: 87  T: 50  G: 38  C: 35

Fasta

 

>rcbA E. coli K12. Version NC_000913.3 GI:556503834
atgtataaaattaccgccactattgaaaaggaaggtggcactcctactaactggacaaga
tattcaaaatctaaactaacgaaatcagaatgcgaaaaaatgctctcaggtaaaaaagaa
gcaggcgtttccagagagcagaaagtaaaactgataaattttaattgcgagaaacttcag
tcctcgagaattgcattgtattcaaattaa
              
                            

Download fasta file
RegulonDB