RegulonDB RegulonDB 10.10: Gene Sequence
yjbB gene sequence


Size: 1632        A: 321  T: 408  G: 467  C: 436

Fasta

 

>yjbB E. coli K12. Version NC_000913.3 GI:556503834
gtgttaacgctgcttcacctgctttctgccgtcgccctgctggtctgggggactcatatt
gttcgaaccggcgtaatgcgcgtcttcggcgcgcgtttgcgtactgtccttagccggagc
gtcgaaaaaaagccgctcgccttttgcgcggggatcggcgttaccgcactggtacagagc
agtaatgccaccaccatgctggtgacctcgtttgtcgctcaggatctggtagccctcgca
ccggctctggtcattgtgctgggtgcagatgtcgggacggcgctaatggcgcgtattctc
accttcgacttatcctggctgtcaccgttacttatttttatcggcgtgatttttttcctc
ggacgcaaacagtcacgcgccgggcaactgggccgcgtcggtattggtcttgggctgatt
ttgctagcgctggagttgattgtgcaggccgtaacgccgatcacccaggcaaacggcgtt
caggtgatctttgcctcgctgaccggcgatattctgctggatgcgctgattggcgcgatg
ttcgccattatcagctactccagccttgctgctgtactgctgaccgcgactctgaccgcc
gcaggcattatctccttccccgtggcgctctgtctggtgattggtgctaacctcggttcc
ggtctgctggcaatgctcaacaacagtgccgccaatgccgcagcccgccgtgtcgcgctg
ggtagtctgctgtttaagctggtgggtagcctgattatcctgccgtttgtccatttgctg
gcagagacaatggggaagttgtcattgccaaaagcggaactggtgatctatttccacgtc
ttctacaaccttgtacgttgcctggtcatgctgccatttgttgacccgatggcacggttt
tgcaaaacgattattcgcgatgaaccggaactggatacccagctacggcctaaacatctg
gatgtcagcgcgctggatacgcccacgcttgctctggcgaacgccgcgcgcgaaaccctg
cgcattggcgacgccatggaacagatgatggaagggttgaataaagtgatgcacggtgag
ccacggcaggagaaagagctgcgtaagctggcagatgatatcaacgttctctacaccgcc
attaagctgtatctggcgcggatgccaaaagaagagctggcggaggaagagtcgcgccgc
tgggcagagatcatcgaaatgtcgctcaaccttgaacaggcctccgatatcgtcgagcgc
atgggcagcgaaattgctgacaaatcactggcagcacggcgggcattttcgcttgatggg
ttgaaggaactggatgcgctctatgagcaattgctcagtaatttaaagctggcaatgtcg
gtgttcttctctggcgatgtcaccagcgctcgtcgtttgcgtcgcagcaaacatcgtttt
cgcattcttaatcgccgctattcccacgcccacgtcgatcgcctgcatcagcaaaacgtg
cagagcattgaaaccagttcgctacatttaggcttactgggagatatgcagcgcctgaac
tcgctgttttgttcggtggcttacagtgtgctggaacagccggatgaagatgaaggacgg
gacgagtattaa
              
                            

Download fasta file
RegulonDB